circad | circRNAs associated with diseases

circMED13
Gene	MED13	Organism	Human
Genome Locus	chr17:60061531-60062451:-	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	29221160
Experimental Method
Sample Type	Cell Lines	Comparison	Breast Cancer Stem Cells (BCSCs) vs non- BCSCs
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATCGGCTACTATCAACAGAACCTC Reverse GAGTAGGAATGTCTGACTGAGGGA	Statistics	Fold Change : Downregulated,3 pvalue : p=0.01532
Citation
Yan, N, Xu, H, Zhang, J, Xu, L, Zhang, Y, Zhang, L, Xu, Y, Zhang, F (2017). Circular RNA profile indicates circular RNA VRK1 is negatively related with breast cancer stem cells. Oncotarget, 8, 56:95704-95718.